Interleukin-8 induces neutrophil accumulation but not protease secretion in the canine trachea
…, JB Richman-Eisenstat, BP Housset… - … of Physiology-Lung …, 1992 - journals.physiology.org
The neutrophil enzyme elastase is a potent secretagogue of airway secretory cells, and
elastase is present in high concentrations in sputum of patients with hypersecretion (eg, cystic …
elastase is present in high concentrations in sputum of patients with hypersecretion (eg, cystic …
Pseudomonas-induced neutrophil recruitment in the dog airway in vivo is mediated in part by IL-8 and inhibited by a leumedin
…, JB Richman-Eisenstat, BP Housset… - European …, 1994 - Eur Respiratory Soc
A bacteria-free supernatant of Pseudomonas aeruginosa induces the production of neutrophil
chemotactic activity in human bronchial epithelial cells in vitro that is due to the potent …
chemotactic activity in human bronchial epithelial cells in vitro that is due to the potent …
Gefitinib, an EGFR inhibitor, prevents hepatocellular carcinoma development in the rat liver with cirrhosis
E Schiffer, C Housset, W Cacheux, D Wendum… - Hepatology, 2005 - journals.lww.com
… fragment; EGFR forward 5′‐GACACCTGCCCACCACTCAT‐3′; Reverse 5′‐CTCCCTGCCTCTGCTCACAT‐3′,
generating a 799‐bp fragment. The cDNA prepared from 200 ng …
generating a 799‐bp fragment. The cDNA prepared from 200 ng …
Continuous positive airway pressure during fiberoptic bronchoscopy in hypoxemic patients: a randomized double-blind study using a new device
…, JC RICHARD, H BAKTHIARI, B HOUSSET… - American Journal of …, 2000 - atsjournals.org
Fiberoptic bronchoscopy (FOB) may worsen oxygenation and clinical status in severely
hypoxemic patients. We conducted a prospective, randomized double-blind trial to compare the …
hypoxemic patients. We conducted a prospective, randomized double-blind trial to compare the …
Hepatocellular hypoxia-induced vascular endothelial growth factor expression and angiogenesis in experimental biliary cirrhosis
…, B Galy, N Sebbagh, J Raleigh, C Housset… - The American journal of …, 1999 - Elsevier
… Three bands at 434, 565, and 687 bp were amplified in the … The band at 687 bp corresponding
to the 188-amino-acid … In contrast, the bands at 434 and 565 bp, corresponding to the …
to the 188-amino-acid … In contrast, the bands at 434 and 565 bp, corresponding to the …
Nocturia is an independent predictive factor of prevalent hypertension in obstructive sleep apnea patients
…, S Dias-Domingos, F Martin, B Stach, B Housset… - Sleep medicine, 2015 - Elsevier
… sleep duration/quality and BP. In normal individuals, the BP profile is characterized by a 10…
, which is termed the normal “dipping pattern” of BP at night. The use of ABPM has allowed to …
, which is termed the normal “dipping pattern” of BP at night. The use of ABPM has allowed to …
Prefixed equimolar nitrous oxide and oxygen mixture reduces discomfort during flexible bronchoscopy in adult patients: a randomized, controlled, double-blind trial
…, C Fuhrman, S Lasry, P Onody, B Housset - Chest, 2005 - Elsevier
… The primary outcome was stress as assessed by pulse rate and systemic BP during the
procedure. Secondary outcomes were self-assessed pain using a visual analog scale (VAS) and …
procedure. Secondary outcomes were self-assessed pain using a visual analog scale (VAS) and …
Emergence of and takeover by hepatitis B virus (HBV) with rearrangements in the pre-S/S and pre-C/C genes during chronic HBV infection
A Tran, D Kremsdorf, F Capel, C Housset… - Journal of …, 1991 - Am Soc Microbiol
… results is the detection of a DNA insertion of 36 bp in the N-terminal part of the C ORF. The
first 26 bp of this sequence is homologous with the last 26 bp of an insert found in the pre-C …
first 26 bp of this sequence is homologous with the last 26 bp of an insert found in the pre-C …
Performance and limitations of steatosis biomarkers in patients with nonalcoholic fatty liver disease
…, R Pais, F Charlotte, C Housset… - Alimentary …, 2014 - Wiley Online Library
… All patients underwent measurements of blood pressure (BP), weight, height and waist …
for this lipid abnormality, systolic BP ≥130 mmHg or diastolic BP ≥85 mmHg or treatment for …
for this lipid abnormality, systolic BP ≥130 mmHg or diastolic BP ≥85 mmHg or treatment for …
Serum adipokine levels predictive of liver injury in non‐alcoholic fatty liver disease
…, F Paye, JP Bastard, R Poupon, C Housset… - Liver …, 2009 - Wiley Online Library
Aims: The aim of this study was to determine whether serum levels of adipokines, including
the ratio of serum adiponectin to leptin (A/L) levels could predict the severity of liver injury in …
the ratio of serum adiponectin to leptin (A/L) levels could predict the severity of liver injury in …